zgc:172096

Ensembl ID:
ENSDARG00000074665
ZFIN ID:
ZDB-GENE-080220-44
Description:
hypothetical protein LOC572146 [Source:RefSeq peptide;Acc:NP_001121732]
Human Orthologue:
CDK14
Human Description:
cyclin-dependent kinase 14 [Source:HGNC Symbol;Acc:8883]
Mouse Orthologue:
Cdk14
Mouse Description:
cyclin-dependent kinase 14 Gene [Source:MGI Symbol;Acc:MGI:894318]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1175 Essential Splice Site Confirmed mutation in F2 line During 2018
sa2845 Essential Splice Site F2 line generated During 2018
sa18680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1175
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034421 Essential Splice Site 77 310 2 10
ENSDART00000100602 Essential Splice Site 77 324 2 10
Genomic Location (Zv9):
Chromosome 16 (position 57603519)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54196939
GRCz11 16 54078431
KASP Assay ID:
554-1085.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTGGCAAAGAGTCTCCCAAACTGCGCAGACACTCCAGCCCCAGCTCT[G/A]TGAGTCTCTCAACAACATTATACTACAGGCTAAAGAATTCCGCATTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2845
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034421 Essential Splice Site 189 310 7 10
ENSDART00000100602 Essential Splice Site 189 324 7 10
Genomic Location (Zv9):
Chromosome 16 (position 57565016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54158436
GRCz11 16 54039928
KASP Assay ID:
554-2684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCAATATGATTTGTGATGCTCACAGWGAACTCTTCTGTTGTTTCCGC[A/T]GTTGTTCCTCTTCCAGTTATTGAGGGGTTTGTCGTATATTCATCAGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034421 Nonsense 251 310 8 10
ENSDART00000100602 Nonsense 251 324 8 10
Genomic Location (Zv9):
Chromosome 16 (position 57549458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54142878
GRCz11 16 54024370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCCGTCCCCAGCCACACRTACTCTAATGAGGTGGTGACGCTGTGGTA[T/A]CGTCCTCCAGATGTGCTGCTCGGCTCKACAGACTACTCCACCTGTCWGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link