ZCCHC6

Ensembl ID:
ENSDARG00000074645
Description:
zinc finger, CCHC domain containing 6 [Source:HGNC Symbol;Acc:25817]
Human Orthologue:
ZCCHC6
Human Description:
zinc finger, CCHC domain containing 6 [Source:HGNC Symbol;Acc:25817]
Mouse Orthologue:
Zcchc6
Mouse Description:
zinc finger, CCHC domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2387179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26633 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25321 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109487 Essential Splice Site 302 877 8 27
Genomic Location (Zv9):
Chromosome 5 (position 72332340)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68693672
GRCz11 5 69465969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCGGGATCTAAAAGACTGGCCCAAAAAGAGGATTGCAATAGAAGG[T/G]ACTGATCACATCTTGGCTTGAGAAATCATGCTAAAAAACATGCCGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109487 Nonsense 808 877 25 27
Genomic Location (Zv9):
Chromosome 5 (position 72322341)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68683673
GRCz11 5 69455970
KASP Assay ID:
554-7859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACCGGGAGTCGGTGGGTGAGCTGTGGCTCGGCCTGCTGCAGTTTTA[C/G]ACTGAGACCTTCGACTTCAGGGAGTCTGTGATCTGTATCCGCAGAAAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link