
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-201c1.1
- Ensembl ID:
- ENSDARG00000074626
- ZFIN ID:
- ZDB-GENE-081104-353
- Human Orthologue:
- LRDD
- Human Description:
- leucine-rich repeats and death domain containing [Source:HGNC Symbol;Acc:16491]
- Mouse Orthologue:
- Lrdd
- Mouse Description:
- leucine-rich and death domain containing Gene [Source:MGI Symbol;Acc:MGI:1889507]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1707 | Essential Splice Site | Available for shipment | Available now |
sa14411 | Essential Splice Site | Available for shipment | Available now |
sa44222 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1707
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110105 | None | 752 | None | 17 | |
ENSDART00000144907 | Essential Splice Site | 486 | 942 | 6 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4743896)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4397596 GRCz11 25 4524123 - KASP Assay ID:
- 554-1653.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGAGGAAGTGACAAACACAGCTGCAGGCCTGGAGGACGTCCTGCACGGG[T/C]CAGCCAATCAGATCAATCACAGACAAACAACRTATTTCATATTGCTGCTT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa14411
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110105 | Essential Splice Site | 346 | 752 | 6 | 17 |
ENSDART00000144907 | Essential Splice Site | 544 | 942 | 7 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4742115)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4395815 GRCz11 25 4522342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGTTTCCCTCCAAACTGTACAGCGGAGACGCGCACCGTCACACTGCAG[G/A]TCTGTACAATAATACAGAATTCTGAATTACATGATTCAATATTTGTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44222
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110105 | Nonsense | 431 | 752 | 9 | 17 |
ENSDART00000144907 | Nonsense | 629 | 942 | 9 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4739327)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4393027 GRCz11 25 4519554 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTGGACAGACGTCACCGCTCAAGTGTCCCTGTACGTCACACACATCTA[C/A]GCCGTCTTCTTCATCACACACTTCTCATGGTGAGCAACTGCAAACACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: