wdr67

Ensembl ID:
ENSDARG00000074623
ZFIN ID:
ZDB-GENE-061218-4
Human Orthologue:
WDR67
Human Description:
WD repeat domain 67 [Source:HGNC Symbol;Acc:30888]
Mouse Orthologue:
Wdr67
Mouse Description:
WD repeat domain 67 Gene [Source:MGI Symbol;Acc:MGI:2684931]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42725 Nonsense Mutation detected in F1 DNA During 2018
sa36133 Nonsense Mutation detected in F1 DNA During 2018
sa45575 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114528 Nonsense 331 1070 7 22
Genomic Location (Zv9):
Chromosome 16 (position 27539228)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25384915
GRCz11 16 25299947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGTCACCATATTGTCGCAGTGATGGACAGTGGAGCTATTAAAATCTA[T/G]GATGTGCGAAGTCTCACCACAGAAATCAGTAAGGTAAATTACTCTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114528 Nonsense 722 1070 15 22
Genomic Location (Zv9):
Chromosome 16 (position 27547994)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25393681
GRCz11 16 25308713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCATGCTGAGGCGGTCAGACAGCAGGCTGAGTTTGAGGCCTGGTA[T/G]AAACAGCAGGAGCTGCTTCTGCAAGGAGAAGAGCAACGGAGACTAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114528 Essential Splice Site 942 1070 20 22
Genomic Location (Zv9):
Chromosome 16 (position 27553587)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25399274
GRCz11 16 25314306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATTCTAAAAAGTGACTGTTCTTTAACATTATTTTGGTATGCTTTTA[G/A]TGGGATGATATAGTAGCCAAACAAGCCGAACGTGAGGACAAAAGATGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link