wdr37

Ensembl ID:
ENSDARG00000074611
ZFIN ID:
ZDB-GENE-030131-8101
Description:
WD repeat-containing protein 37 [Source:RefSeq peptide;Acc:NP_001161736]
Human Orthologue:
WDR37
Human Description:
WD repeat domain 37 [Source:HGNC Symbol;Acc:31406]
Mouse Orthologue:
Wdr37
Mouse Description:
WD repeat domain 37 Gene [Source:MGI Symbol;Acc:MGI:1920393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44073 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111491 Nonsense 228 494 8 13
ENSDART00000134598 Nonsense 228 494 9 14
ENSDART00000142407   None 165 None 7
Genomic Location (Zv9):
Chromosome 24 (position 3585022)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3475515
GRCz11 24 3507302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGTTCCTGACAGCGTCCGGGGACCAGACGGCTCACATCTGGCGTTA[C/A]ATGGTACAGCTGCCACTTCCACAGCCTCCAGCAGACATCAGCGTGAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link