Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000074607
- Ensembl ID:
- ENSDARG00000074607
- Mouse Orthologues:
- AC135640.1, AC165356.1
- Mouse Descriptions:
- predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]
- predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa1506 | Nonsense | Available for shipment | Available now |
| sa33078 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1506
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000049593 | Nonsense | 55 | 358 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 3 (position 4573763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 4190539 GRCz11 3 3972356 - KASP Assay ID:
- 554-1431.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGATCTGTCAGATGAAATGAGATCAAACTGTGAATCACTGAATGGAAAC[A/T]GATCAAATCTTGAGAAACACATCCTGAAGACACTGGCAGAAGAGGAGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33078
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000049593 | Nonsense | 317 | 358 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 3 (position 4574551)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 4189751 GRCz11 3 3971568 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCAACTGGAGCATCACTCCTGATCTCTCTGAACTGCCCTACTGGAAGTG[G/A]TTTGTGTGCAGATTCCAGAAAGATCTGGAGAATTACTACAATAACACATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
