
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC565651
- Ensembl ID:
- ENSDARG00000074582
- Human Orthologues:
- AC144571.1, GFRA1, GFRA2, GFRA3
- Human Descriptions:
- GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
- GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
- GDNF family receptor alpha 3 [Source:HGNC Symbol;Acc:4245]
- Mouse Orthologues:
- Gfra1, Gfra2, Gfra3
- Mouse Descriptions:
- glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:
- glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:
- glial cell line derived neurotrophic factor family receptor alpha 3 Gene [Source:MGI Symbol;Acc:MGI:
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12119 | Nonsense | Available for shipment | Available now |
sa22469 | Nonsense | Available for shipment | Available now |
sa38993 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38994 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12119
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108987 | Nonsense | 123 | 431 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 23685937)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 22385727 GRCz11 14 22682972 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGCTTAACCTGGTAGAGAACTATCCGTATGAAACAGTGGAGAAAGGCTA[T/A]GAGTTTGTCCGTCTGGCTTCCATCACTGCAGGTAAGGTAATAGCTTGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22469
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108987 | Nonsense | 165 | 431 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 23692651)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 22392441 GRCz11 14 22689686 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCAAAGCTTGCAACATTGATGACGTTTGCCAGAGACTGCGCACCGAGTA[T/A]GTGTCAACATGCATCAAGCCCTCCACCAAATCGGGTTTGTGTAACCGATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38993
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108987 | Nonsense | 176 | 431 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 23692683)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 22392473 GRCz11 14 22689718 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGACTGCGCACCGAGTATGTGTCAACATGCATCAAGCCCTCCACCAAAT[C/A]GGGTTTGTGTAACCGATCAAGGTGCAACAAGGCCTTGCGGCGATTCTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38994
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108987 | Nonsense | 188 | 431 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 23692719)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 22392509 GRCz11 14 22689754 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCCTCCACCAAATCGGGTTTGTGTAACCGATCAAGGTGCAACAAGGCCT[T/A]GCGGCGATTCTTTGACAGAGTCCCTGCAGAGTACACCCACGAGCTGCTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: