unc5a

Ensembl ID:
ENSDARG00000074543
ZFIN IDs:
ZDB-GENE-080219-19, ZDB-GENE-080219-19
Description:
unc-5 homolog A [Source:RefSeq peptide;Acc:NP_001107937]
Human Orthologues:
BAI1, BAI2, BAI3
Human Descriptions:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
brain-specific angiogenesis inhibitor 2 [Source:HGNC Symbol;Acc:944]
brain-specific angiogenesis inhibitor 3 [Source:HGNC Symbol;Acc:945]
Mouse Orthologues:
Bai1, Bai2, Bai3
Mouse Descriptions:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]
brain-specific angiogenesis inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:2451244]
brain-specific angiogenesis inhibitor 3 Gene [Source:MGI Symbol;Acc:MGI:2441837]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22555 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114462 Essential Splice Site 227 390 4 7
ENSDART00000121723 Essential Splice Site 419 749 7 13
ENSDART00000122969 Essential Splice Site 449 534 7 10
Genomic Location (Zv9):
Chromosome 14 (position 52217567)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150681.1 199922
GRCz11 14 51246708
KASP Assay ID:
2260-7954.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGCACTTTCAACTTCCTGGGCGGACGACTGACGCTGCCCAACACGGG[T/C]GAGACTCCATTCAGGAGATAAACTGGACAATATATTCAATTCAGTTCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link