zgc:165467

Ensembl ID:
ENSDARG00000074531
ZFIN ID:
ZDB-GENE-070820-7
Description:
zgc:165467 (zgc:165467), mRNA [Source:RefSeq DNA;Acc:NM_001103113]
Human Orthologue:
SPAG9
Human Description:
sperm associated antigen 9 [Source:HGNC Symbol;Acc:14524]
Mouse Orthologue:
Spag9
Mouse Description:
sperm associated antigen 9 Gene [Source:MGI Symbol;Acc:MGI:1918084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19976 Nonsense Available for shipment Available now
sa40032 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113938 Nonsense 360 1289 9 30
ENSDART00000148132 Nonsense 360 1274 9 30

The following transcripts of ENSDARG00000074531 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 18078324)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18199644
GRCz11 3 18349384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAATGATGTGGTAAACTGTGTTGCGTTGTGTTGAAGTACGCCGACC[C/T]GAGGGATTGAGAACATGGCGTTTGACCGCAACACAGAATCCCTGTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113938 Nonsense 1045 1289 25 30
ENSDART00000148132 Nonsense 1030 1274 25 30

The following transcripts of ENSDARG00000074531 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 18051823)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18173143
GRCz11 3 18322883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTGTGGTTCACGATAAAGTGTGGTGCGGCTACAGGAACAAGATCTA[C/A]ATCATTCAGCCCAAAGCTATGAAAATCGAGGTTCAGCATTATGTTTTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link