LOC559131

Ensembl ID:
ENSDARG00000074519
Human Orthologue:
AC114947.1
Human Description:
Serine/threonine-protein kinase NIM1 [Source:UniProtKB/Swiss-Prot;Acc:Q8IY84]
Mouse Orthologues:
E130304F04Rik, E130304F04Rik
Mouse Descriptions:
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35015 Missense Mutation detected in F1 DNA During 2018
sa45421 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6190 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111841 Missense 18 445 2 5
Genomic Location (Zv9):
Chromosome 11 (position 6248578)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6216761
GRCz11 11 6214016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAATTTGACTTCACTGGTAATTTCCTTTTTTTTTTTGTCTTATCCAA[G/A]GTACCAAAACACTAAATATCTGGGCAAAGCGGCACGCAAAGAAAGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111841 Essential Splice Site 34 445 2 5
Genomic Location (Zv9):
Chromosome 11 (position 6248628)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6216811
GRCz11 11 6214066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACCAAAACACTAAATATCTGGGCAAAGCGGCACGCAAAGAAAGGAAA[G/A]AATGAGGCAGCAGCACAACCCGTTCAGAAAGAGGCAGAAGCACGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111841 Nonsense 337 445 5 5
Genomic Location (Zv9):
Chromosome 11 (position 6257532)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6225715
GRCz11 11 6222970
KASP Assay ID:
554-5067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCAGCACACTGTCACAGCTGATGATCTGCTCCTGGATGCAGTGCATC[G/T]AATACCCCAAACCYTACCCCACATTCAGCGGGACACCCGGCTATCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link