zgc:171674

Ensembl ID:
ENSDARG00000074507
ZFIN ID:
ZDB-GENE-070928-17
Description:
regulator of microtubule dynamics protein 1 [Source:RefSeq peptide;Acc:NP_001098576]
Human Orthologue:
FAM82B
Human Description:
family with sequence similarity 82, member B [Source:HGNC Symbol;Acc:24285]
Mouse Orthologue:
Fam82b
Mouse Description:
family with sequence similarity 82, member B Gene [Source:MGI Symbol;Acc:MGI:1913552]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44208 Nonsense Mutation detected in F1 DNA During 2018
sa37971 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112680 Nonsense 63 295 2 10
Genomic Location (Zv9):
Chromosome 24 (position 43916383)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42226045
GRCz11 24 42147778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGTCATACCTGATCTACCAGAGAGTGTCTCGTCTCGCTCCGGTGTG[T/A]GCGCTGAACTCAGGTCAGTTCTTCATCATCATCATCATCATCATCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112680 Essential Splice Site 97 295 4 10
Genomic Location (Zv9):
Chromosome 24 (position 43915467)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42225129
GRCz11 24 42146862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGTGTGAGTCAGTAACTCTGTGTGTGTGTGTGTGTGTGTGTGCACA[G/A]TGGTGACGCAGAGTTCCTGTGGCGTCTGGCGCGTGTGTGTCGTGATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112680 Nonsense 161 295 5 10
Genomic Location (Zv9):
Chromosome 24 (position 43915178)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42224840
GRCz11 24 42146573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTNNNNCTGCAGTGGTTCGCCATCTGCCTCAGTGAWGTGGGCGATTAT[G/T]AGGGCATCAAAGTGAAGATTGGAAACTCCTACATCATCAGAGAACACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link