tmem222

Ensembl ID:
ENSDARG00000074503
ZFIN ID:
ZDB-GENE-090303-4
Description:
LOC558134 protein [Source:UniProtKB/TrEMBL;Acc:Q0D291]
Human Orthologue:
TMEM222
Human Description:
transmembrane protein 222 [Source:HGNC Symbol;Acc:25363]
Mouse Orthologue:
Tmem222
Mouse Description:
transmembrane protein 222 Gene [Source:MGI Symbol;Acc:MGI:1098568]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31034 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115412 Nonsense 106 200 5 7
ENSDART00000134778 Nonsense 131 225 4 6
Genomic Location (Zv9):
Chromosome 19 (position 30473678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14160304
GRCz11 19 14022499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATCTGTTTTATTCTCAGGTACTGGATGTTAGATGTAAGTAAAGTGTA[T/A]ACCAGTGGGTCTAATGCGTGGGACACAGCAGTTCACAACGCATCAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link