zmiz1

Ensembl ID:
ENSDARG00000074502
ZFIN ID:
ZDB-GENE-080220-27
Description:
zinc finger MIZ domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001106810]
Human Orthologue:
ZMIZ1
Human Description:
zinc finger, MIZ-type containing 1 [Source:HGNC Symbol;Acc:16493]
Mouse Orthologue:
Zmiz1
Mouse Description:
zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16557 Essential Splice Site Available for shipment Available now
sa42221 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12497 Nonsense Available for shipment Available now
sa6309 Nonsense Mutation detected in F1 DNA During 2018
sa22326 Essential Splice Site Available for shipment Available now
sa10512 Essential Splice Site Available for shipment Available now
sa22327 Nonsense Available for shipment Available now
sa38949 Nonsense Mutation detected in F1 DNA During 2018
sa22328 Essential Splice Site Available for shipment Available now
sa15810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884   None 1024 None 22
ENSDART00000113617 Essential Splice Site 23 1068 1 21
ENSDART00000114143   None 1024 None 21
ENSDART00000143569 Essential Splice Site 23 246 3 8
Genomic Location (Zv9):
Chromosome 13 (position 30721979)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30367927
GRCz11 13 30498377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAGGCACATACAGCAGACCAATGACAGGCTGCTGTGCATCAAACAG[G/A]TGAGGAGAAAAGACACCGCGGTGACACAACCACAGTCTGTCTGTCCTTYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Essential Splice Site 6 1024 3 22
ENSDART00000113617 Essential Splice Site 62 1068 3 21
ENSDART00000114143 Essential Splice Site 6 1024 2 21
ENSDART00000143569 Essential Splice Site 62 246 5 8
Genomic Location (Zv9):
Chromosome 13 (position 30744459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30390407
GRCz11 13 30520857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAAAAGCATACATAATCTCTAAAATGTTGTTCTGTTATTCTCCAC[A/T]GGTTGTAAGCCGTGTGGCAGCGCAGCAGGGTTTTGATCTGGACCTCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Nonsense 84 1024 5 22
ENSDART00000113617 Nonsense 128 1068 4 21
ENSDART00000114143 Nonsense 84 1024 4 21
ENSDART00000143569 Nonsense 128 246 6 8
Genomic Location (Zv9):
Chromosome 13 (position 30775134)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30421082
GRCz11 13 30551532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCGGCATCAGAAGAATCRTCAGAGCGATCCCCAGGGCAAAGTACCCT[T/A]GCAGCCACCCATGAACTCCATGAAGCCCTCGCTCTCACATGGGTCAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Nonsense 111 1024 6 22
ENSDART00000113617 Nonsense 155 1068 5 21
ENSDART00000114143 Nonsense 111 1024 5 21
ENSDART00000143569 Nonsense 155 246 7 8
Genomic Location (Zv9):
Chromosome 13 (position 30775835)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30421783
GRCz11 13 30552233
KASP Assay ID:
554-4028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGTTTTGTAGTGATGGGTCCTTTCCATATGACAGCGTTCCCTGGCAA[C/T]AAAACGCCAACCAGGCCCCRGGATCATTGTCAGTGGTTACAACGGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Essential Splice Site 136 1024 6 22
ENSDART00000113617 Essential Splice Site 180 1068 5 21
ENSDART00000114143 Essential Splice Site 136 1024 5 21
ENSDART00000143569 Essential Splice Site 180 246 7 8
Genomic Location (Zv9):
Chromosome 13 (position 30775913)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30421861
GRCz11 13 30552311
KASP Assay ID:
2260-6552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTGGTTACAACGGTTTGGGGAGTTACTAATACGTCACAAAGTCAG[G/A]TGAGTCAGACTTACAGTGTTACTGAATCAAAACAGCGACGCTGATAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Essential Splice Site 433 1024 11 22
ENSDART00000113617 Essential Splice Site 477 1068 10 21
ENSDART00000114143 Essential Splice Site 433 1024 10 21
ENSDART00000143569   None 246 None 8
Genomic Location (Zv9):
Chromosome 13 (position 30779143)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30425091
GRCz11 13 30555541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAACTATCTTGGAAWCTTGTTTACATTCTCTCTGCTCATTTCAATTTC[A/T]GCAAGAGCCGTTTAATGGTMAGAACAACAATTTCTCTGGAGGTGGTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Nonsense 605 1024 14 22
ENSDART00000113617 Nonsense 649 1068 13 21
ENSDART00000114143 Nonsense 605 1024 13 21
ENSDART00000143569   None 246 None 8
Genomic Location (Zv9):
Chromosome 13 (position 30782101)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30428049
GRCz11 13 30558499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACGCCACACCACTCACCATCGAGAGGGGCGACAATAAAACATCGCAC[A/T]AACCCCTGCACCTAAAGCACGTTTGTCAACCTGGGAGAAACACCATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Nonsense 753 1024 18 22
ENSDART00000113617 Nonsense 797 1068 17 21
ENSDART00000114143 Nonsense 753 1024 17 21
ENSDART00000143569   None 246 None 8
Genomic Location (Zv9):
Chromosome 13 (position 30785474)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30431422
GRCz11 13 30561872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTCTGTCCCCAGTAAAACAGCGTTATTGGAAGGCCTGGAGGTGGAT[C/T]AGTACATGTGGGGAATTCTCAATGCCATTCAAAAGTAAGTTTATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Essential Splice Site 764 1024 18 22
ENSDART00000113617 Essential Splice Site 808 1068 17 21
ENSDART00000114143 Essential Splice Site 764 1024 17 21
ENSDART00000143569   None 246 None 8
Genomic Location (Zv9):
Chromosome 13 (position 30785509)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30431457
GRCz11 13 30561907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGGAGGTGGATCAGTACATGTGGGGAATTCTCAATGCCATTCAAAA[G/A]TAAGTTTATTATTCACGCAATTTTGTTTTTGCGAGATCTATAAAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110884 Nonsense 802 1024 19 22
ENSDART00000113617 Nonsense 846 1068 18 21
ENSDART00000114143 Nonsense 802 1024 18 21
ENSDART00000143569   None 246 None 8
Genomic Location (Zv9):
Chromosome 13 (position 30785742)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30431690
GRCz11 13 30562140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACATTCAKATAAAGGMGGACCCAGATGGCCCTCTKGCCAAACGTTTC[A/T]AAACCATGAGTYCCAGTCAAATGATCATGCCTAATGTGATGGATATGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link