vps39

Ensembl ID:
ENSDARG00000074471
ZFIN ID:
ZDB-GENE-080530-2
Description:
vam6/Vps39-like protein [Source:RefSeq peptide;Acc:NP_001107012]
Human Orthologue:
VPS39
Human Description:
vacuolar protein sorting 39 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20593]
Mouse Orthologue:
Vps39
Mouse Description:
vacuolar protein sorting 39 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2443189]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14550 Nonsense Available for shipment Available now
sa9171 Nonsense Mutation detected in F1 DNA During 2018
sa18429 Nonsense Available for shipment Available now
sa9687 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113644 Nonsense 333 875 11 24
Genomic Location (Zv9):
Chromosome 17 (position 50614399)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50005216
GRCz11 17 50084285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCWCTTTTTGCAGAAAATGAAGGATGATTCCGATACAGACAAGAGGCAA[C/T]AGATCCATCACAWTCAGAACCTGTTTGCCTTCAACCTGTTCTGCCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113644 Nonsense 575 875 17 24
Genomic Location (Zv9):
Chromosome 17 (position 50627259)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50018076
GRCz11 17 50097145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGATTTTCACGGAGGACCTAACGGAGGTGGARACACTGCCCAGGGAT[C/T]AAGTGTTGAACTTTCTGAAGGAGGGCTTCAAGGAGYTGGCCATCCCATAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113644 Nonsense 697 875 19 24
Genomic Location (Zv9):
Chromosome 17 (position 50630306)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50021123
GRCz11 17 50100192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCTYCTTTTGGGACGTATGGGGAAACACGAGCAGGCTCTGTTCATCTA[T/A]GTCCACATCCTGAAGGACACRCGGAYGGCTGAAGAGTRAGTRAAGTCNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113644 Essential Splice Site 774 875 21 24
Genomic Location (Zv9):
Chromosome 17 (position 50633473)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50024290
GRCz11 17 50103359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCTGAACRTCCTTCAGCTTCACCACAGCAAACTCAACACCACCAAAG[T/A]GAGCGTCCACCRCTAAATCCTAMTAGTGTTKTCRAAAGGACTGACTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link