si:dkey-96f10.1

Ensembl ID:
ENSDARG00000074457
ZFIN ID:
ZDB-GENE-090312-154
Human Orthologue:
PFKFB1
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 [Source:HGNC Symbol;Acc:8872]
Mouse Orthologue:
Pfkfb1
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:107816]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6729 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18547 Nonsense Available for shipment Available now
sa14640 Nonsense Available for shipment Available now
sa32429 Nonsense Available for shipment Available now
sa37638 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012724 Essential Splice Site 25 99 1 3
ENSDART00000103231   None 304 None 8
ENSDART00000139166   None 342 None 10
ENSDART00000146640 Essential Splice Site 25 227 1 5

The following transcripts of ENSDARG00000074457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12900027)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13031960
GRCz11 23 12788037
KASP Assay ID:
554-5297.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATCTGGGTGCCATGGATGAGCAGCAGACTGAGACAGAGAAGAGGCT[G/A]TAAGTCAGACAACTTAAGAAACATTTCTCCATCTTGCTGTATTTTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012724   None 99 None 3
ENSDART00000103231 Nonsense 153 304 3 8
ENSDART00000139166 Nonsense 192 342 5 10
ENSDART00000146640   None 227 None 5

The following transcripts of ENSDARG00000074457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12816318)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12948251
GRCz11 23 12704328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCACATGAGGAGAACAATCCAGACTGCAGAAGCGGTTGGAGTGCCATA[T/A]GAACAATGGAAAGCTCTGAATGAGATTGATGCTGTGAGWACAGTCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012724   None 99 None 3
ENSDART00000103231 Nonsense 193 304 4 8
ENSDART00000139166 Nonsense 232 342 6 10
ENSDART00000146640   None 227 None 5

The following transcripts of ENSDARG00000074457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12816058)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12947991
GRCz11 23 12704068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACACTTTCCTGAGGAGTTTGCCCTCAGAGACCAAGACAAATATCGTTA[T/A]CGATACCCAAAGGGAGAAGTGAGTGTGTTTAAATATGTTACTCATCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012724   None 99 None 3
ENSDART00000103231 Nonsense 218 304 5 8
ENSDART00000139166 Nonsense 257 342 7 10
ENSDART00000146640   None 227 None 5

The following transcripts of ENSDARG00000074457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12800563)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12932496
GRCz11 23 12688573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGATCTGGTTCATCGTTTAGAACCGGTAATCATGGAGCTTGAGCGC[C/T]AGGAGAATGTTCTGGTCATTTGCCATCAGGCTGTCATGCGCTGTCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012724   None 99 None 3
ENSDART00000103231 Nonsense 265 304 7 8
ENSDART00000139166 Nonsense 304 342 9 10
ENSDART00000146640   None 227 None 5

The following transcripts of ENSDARG00000074457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12798928)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12930861
GRCz11 23 12686938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACGATAGAAAATTTATCAGTATTATTTTCTTTTGTATTTCCAGGGTG[T/A]AAAGTTGAGTCAGTGTTCCTGAATGTTGAAGCAGTGAACACACACAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link