zfx

Ensembl ID:
ENSDARG00000074453
ZFIN ID:
ZDB-GENE-061220-2
Human Orthologue:
ZNF639
Human Description:
zinc finger protein 639 [Source:HGNC Symbol;Acc:30950]
Mouse Orthologue:
Zfp639
Mouse Description:
zinc finger protein 639 Gene [Source:MGI Symbol;Acc:MGI:1915028]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16485 Nonsense Available for shipment Available now
sa10983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110652 Nonsense 57 739 2 7
Genomic Location (Zv9):
Chromosome 24 (position 17560074)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16866550
GRCz11 24 17010969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTKTCTGATGTKGAGGGTGAGAAGATCGCGGTGCACGGTCTCACTCAT[G/T]AGGAGCTGGTCATCCAGGAGGCCATMGAGGATGTGGTGGCGGAGTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110652 Nonsense 98 739 2 7
Genomic Location (Zv9):
Chromosome 24 (position 17560199)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16866675
GRCz11 24 17011094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGATGATGACGATGATGAAGGGCTTGGCACCATTGCMGTGGAGACCTG[T/A]GTGATGTCACCTGATGATGKKGCTCTGGAGGATGAAGGGYTGCAGGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link