zgc:101017

Ensembl ID:
ENSDARG00000074451
ZFIN ID:
ZDB-GENE-040801-116
Description:
Meiotic nuclear division protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DC61]
Human Orthologue:
MND1
Human Description:
meiotic nuclear divisions 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24839]
Mouse Orthologue:
Mnd1
Mouse Description:
meiotic nuclear divisions 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924165]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11730 Nonsense Available for shipment Available now
sa39614 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054265 Nonsense 145 220 6 8
ENSDART00000141648 Nonsense 145 205 6 8
Genomic Location (Zv9):
Chromosome 1 (position 24044923)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24496694
GRCz11 1 25187523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATTGAAAGGTCAGCGAGATCAGATGAAGGTCGAAAWAGAGAAGTAC[C/T]AAGAATGTGATCCAGCGGTGGTGGAGGAAATTCGTGAGTAAACTTTTCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054265 Essential Splice Site 171 220 8 8
ENSDART00000141648   None 205 None 8
Genomic Location (Zv9):
Chromosome 1 (position 24071268)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24523039
GRCz11 1 25213868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCGAAAATTCCCTCCATTCACCCCATCTCCCCTTTTCTTCCTTTACC[A/G]GGGGGAACTTTTGGGAACTACCTGATCTCATACCTCCTTACATGCTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link