si:dkey-270k22.4

Ensembl ID:
ENSDARG00000074435
ZFIN ID:
ZDB-GENE-070912-490
Description:
LOC564788 protein [Source:UniProtKB/TrEMBL;Acc:A4QP73]
Human Orthologue:
TTC19
Human Description:
tetratricopeptide repeat domain 19 [Source:HGNC Symbol;Acc:26006]
Mouse Orthologue:
Ttc19
Mouse Description:
tetratricopeptide repeat domain 19 Gene [Source:MGI Symbol;Acc:MGI:1920045]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32952 Nonsense Mutation detected in F1 DNA During 2018
sa18336 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110821 Nonsense 17 403 1 10

The following transcripts of ENSDARG00000074435 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32203873)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32502780
GRCz11 2 32485998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGCGCTGCGCTCTTACTGTCGACAACTAGCTGCACAGGTCTTTCGTT[T/A]GAAGCTTTGTGGTAACGAATGTCCGAGAAATGCACCGGGTTGTAGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110821 Nonsense 109 403 2 10

The following transcripts of ENSDARG00000074435 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32203410)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32502317
GRCz11 2 32485535
KASP Assay ID:
2259-2220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGCCTTTTCGCTTWTTGGAGGCTCAGAKGAGAAAACCGAGGAGCAA[A/T]AACTTGAGGATGAACTTATTCTGCTCTTGAAGAAAGCCAAGGTAAATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link