
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
MDGA1
- Ensembl ID:
- ENSDARG00000074376
- Description:
- MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
- Human Orthologue:
- MDGA1
- Human Description:
- MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
- Mouse Orthologue:
- Mdga1
- Mouse Description:
- MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44795 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14556 | Essential Splice Site | Available for shipment | Available now |
sa19070 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11282 | Nonsense | Available for shipment | Available now |
sa22373 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44795
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110092 | Essential Splice Site | 193 | 756 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 45036237)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44279736 GRCz11 13 44416640 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGAGCAAAGACAACGGCGTGGACATCTATGAGCCTCTGTACACACAGG[T/C]ACAACATACAAATTTGTCTTTGTGTCATGATTTATGATGGTTATATATGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14556
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110092 | Essential Splice Site | 537 | 756 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44974778)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44218277 GRCz11 13 44355181 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCCTCAATATTAAACGCAGACTGGCTCAGGTGCAGCTCAACGTGGAGTG[T/A]AAGTGTTTTAAATTGCTACTAGACCAATCTTAAAGTAGYTGGTTATAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19070
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110092 | Nonsense | 569 | 756 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44959981)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44203480 GRCz11 13 44340384 - KASP Assay ID:
- 2260-6916.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAAC[C/T]GAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTACGAAACTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11282
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110092 | Nonsense | 583 | 756 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44959939)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44203438 GRCz11 13 44340342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCCMAACCGAATAGTCAGCGCCTACTGGTACCGYAATGGAAWACCTTTA[C/T]GMAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAAYTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22373
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110092 | Nonsense | 674 | 756 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44947999)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44191498 GRCz11 13 44328402 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAGCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGA[C/T]AGGTACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: