
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100330316
- Ensembl ID:
- ENSDARG00000074357
- Human Orthologue:
- BICD1
- Human Description:
- bicaudal D homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1049]
- Mouse Orthologue:
- Bicd1
- Mouse Description:
- bicaudal D homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1101760]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20182 | Nonsense | Available for shipment | Available now |
sa12371 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20182
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113062 | Nonsense | 244 | 846 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 3142218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 1547203 GRCz11 4 3288062 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGAGAGCCAATTAGAGGAGGCGTTGGATGCCCTGAAAAACGAGCGCGAG[C/T]AGAAAAACATTTTGCGTAAAGAATTAGCCCACCATCTAACCGTGTGCGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12371
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113062 | Nonsense | 814 | 846 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 3134183)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 1539168 GRCz11 4 3296097 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAAACTGGCCCTCACGCAGAAACTGGAGGACCTGGAGTTCGACCAGGAG[C/T]AGACACACCGCAYCCGAGTGGGAAAACCMTCCCGTATGAGGAGCAGCACG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Emphysema-related traits: Genome-wide association study identifies BICD1 as a susceptibility gene for emphysema. (View Study)
- Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Pancreatic cancer: Genome-wide association study of pancreatic cancer in Japanese population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: