
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fxn
- Ensembl ID:
- ENSDARG00000074356
- ZFIN ID:
- ZDB-GENE-070209-286
- Description:
- frataxin, mitochondrial [Source:RefSeq peptide;Acc:NP_001076485]
- Human Orthologue:
- FXN
- Human Description:
- frataxin [Source:HGNC Symbol;Acc:3951]
- Mouse Orthologue:
- Fxn
- Mouse Description:
- frataxin Gene [Source:MGI Symbol;Acc:MGI:1096879]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34315 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11321 | Essential Splice Site | Available for shipment | Available now |
sa16490 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34315
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113008 | None | 169 | 1 | 6 | |
ENSDART00000142577 | Nonsense | 25 | 200 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11381395)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11287729 GRCz11 8 11325434 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGTCGTTTGTATCAACTGAGCTTGAGCTCCAGATGGAAATGTTACCAA[C/T]AAATCTCCAGACTGTCAACAATGAGCAGTGGACTTAATGTAGGTGAAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11321
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113008 | Essential Splice Site | 6 | 169 | None | 6 |
ENSDART00000142577 | Essential Splice Site | 37 | 200 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11381355)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11287769 GRCz11 8 11325474 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGTTACCAACAAATCTCCAGACTGTCAACAAYGAGCAGTGGACTTAATG[T/C]AGGTGAAGTTAAAACAAACATCTCTGACTGGTTAGCATGAATGGATTNNNNNNCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16490
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113008 | Nonsense | 58 | 169 | 4 | 6 |
ENSDART00000142577 | Nonsense | 89 | 200 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11377229)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11291895 GRCz11 8 11329600 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAACTATTGCAATGRTTGTTTTGTATAGAGAAATATCAGAGGCCGAGTA[T/A]GAGAGACTAGCAGAAGAGACGCTGGATGCATTAGCAGATTATTTTGAAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: