zgc:171550

Ensembl ID:
ENSDARG00000074341
ZFIN ID:
ZDB-GENE-080204-31
Description:
Aminoglycoside phosphotransferase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A8WFT
Human Orthologue:
AGPHD1
Human Description:
aminoglycoside phosphotransferase domain containing 1 [Source:HGNC Symbol;Acc:34403]
Mouse Orthologue:
Agphd1
Mouse Description:
aminoglycoside phosphotransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24213 Nonsense Available for shipment Available now
sa24214 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110254 Nonsense 98 355 2 5
Genomic Location (Zv9):
Chromosome 22 (position 38395441)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35543512
GRCz11 22 35520453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCCTGCGCAGACCGCTTTACCCACACTGACTGGACAACTGATGAGCT[T/A]GGAGGAATTTGGTAAGTGTCAATTGTTAATTTTATGAAAAATTTAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110254 Essential Splice Site 210 355 5 5
Genomic Location (Zv9):
Chromosome 22 (position 38401552)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35549609
GRCz11 22 35526550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGTGTGTGTGTGTTTTCTTTTCTTACAATATTTTTATTGCATTGC[A/G]GGTATCAACCACGGAGATTTCAATGACCACAACCTCATAGTGAAACCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link