wu:fb69f10

Ensembl ID:
ENSDARG00000074332
ZFIN IDs:
ZDB-GENE-030131-1387, ZDB-GENE-030131-1387, ZDB-GENE-081104-82
Description:
Novel protein similar to H.sapiens SPEN, spen homolog, transcriptional regulator (Drosophila) (SPEN)
Human Orthologue:
SPEN
Human Description:
spen homolog, transcriptional regulator (Drosophila) [Source:HGNC Symbol;Acc:17575]
Mouse Orthologue:
Spen
Mouse Description:
SPEN homolog, transcriptional regulator (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891706]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37390 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110807 Essential Splice Site 545 3103 9 18
ENSDART00000138707   None 457 None 5
ENSDART00000141411 Essential Splice Site 547 691 8 11

The following transcripts of ENSDARG00000074332 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 172167)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 168320
GRCz11 22 141349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCAGTACCTGACGCGACACTTCTGCCGTTATGGCCCCGTGGTGAAG[G/A]TATGTGTGTTGATGCAGTGTGTGTGTTTGTGTGTGTGTGTGCGCGCGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link