si:dkey-27b3.5

Ensembl ID:
ENSDARG00000074316
ZFIN ID:
ZDB-GENE-091118-115
Human Orthologue:
ITGA1
Human Description:
integrin, alpha 1 [Source:HGNC Symbol;Acc:6134]
Mouse Orthologue:
Itga1
Mouse Description:
integrin alpha 1 Gene [Source:MGI Symbol;Acc:MGI:96599]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34849 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18063 Nonsense Available for shipment Available now
sa41595 Nonsense Mutation detected in F1 DNA During 2018
sa41596 Nonsense Mutation detected in F1 DNA During 2018
sa27560 Nonsense Mutation detected in F1 DNA During 2018
sa24864 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Essential Splice Site 482 1183 13 30
ENSDART00000145596 Essential Splice Site 482 1187 13 30
Genomic Location (Zv9):
Chromosome 10 (position 8897797)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8973753
GRCz11 10 8807312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTCCATTTCCTTTTCTGGAGCATTAATAAGCATGTCATGTTGTTCTT[A/T]GATTGGCTCCTATTTCGGCAGCGTCCTTCAAACGCATGACATCGATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Nonsense 786 1183 18 30
ENSDART00000145596 Nonsense 785 1187 18 30
Genomic Location (Zv9):
Chromosome 10 (position 8915857)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8991813
GRCz11 10 8825372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGTGACGCTGGAATTCGGTCTAGCRGATGAAGACAAGGGTCYAGTTT[T/A]GGATGGAGAATTACCCACATCCCTCAACAAGACTGTAAGTTTTCCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Nonsense 857 1183 20 30
ENSDART00000145596 Nonsense 860 1187 20 30
Genomic Location (Zv9):
Chromosome 10 (position 8919510)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8995466
GRCz11 10 8829025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACACTGGAGACAACGCTTATAATACCAAAGTTACACTGAGCCACACT[G/T]AAAATATCAACTATGTCAAAGTGGAGGTAAGAAGAATTTAGAGAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Nonsense 1054 1183 26 30
ENSDART00000145596 Nonsense 1058 1187 26 30
Genomic Location (Zv9):
Chromosome 10 (position 8925781)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9001737
GRCz11 10 8835296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAGCAAACCACATTCACTGAACACAAAAAAAGAGACCCTGAGCATCTA[T/A]CTTTTGGTGAGTAACCACTGCTTTTTTGATATGCGCATAGACATATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Nonsense 1129 1183 29 30
ENSDART00000145596 Nonsense 1133 1187 29 30
Genomic Location (Zv9):
Chromosome 10 (position 8930817)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9006773
GRCz11 10 8840332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTTCACAATTGTGATGAGTGTTGCATTTATTATGCAGGTAAGGATT[C/T]AAGTCACCAAAGACATACGAACTGGAATCCCACTGTGGATTATTATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112101 Nonsense 1135 1183 29 30
ENSDART00000145596 Nonsense 1139 1187 29 30
Genomic Location (Zv9):
Chromosome 10 (position 8930835)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9006791
GRCz11 10 8840350
KASP Assay ID:
554-7712.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGTTGCATTTATTATGCAGGTAAGGATTCAAGTCACCAAAGACATA[C/T]GAACTGGAATCCCACTGTGGATTATTATCCTTAGTATTCTAATAGGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link