cnnm4

Ensembl ID:
ENSDARG00000074309
ZFIN ID:
ZDB-GENE-070705-181
Description:
Novel protein similar to human and mouse cyclin M4 (CNNM4) [Source:UniProtKB/TrEMBL;Acc:A5WWF8]
Human Orthologue:
CNNM4
Human Description:
cyclin M4 [Source:HGNC Symbol;Acc:105]
Mouse Orthologue:
Cnnm4
Mouse Description:
cyclin M4 Gene [Source:MGI Symbol;Acc:MGI:2151060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40371 Nonsense Mutation detected in F1 DNA During 2018
sa45189 Nonsense Mutation detected in F1 DNA During 2018
sa13735 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Nonsense 236 769 1 8
ENSDART00000132406 Nonsense 237 602 1 4
Genomic Location (Zv9):
Chromosome 5 (position 14675298)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12972735
GRCz11 5 13472952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTAGGAAAGGAAACTATCTGTTGTGTTCGCTTCTTCTGGGAAATGTGT[T/A]GGTGAACACCACGTTAACCATCCTACTGGATGATCTCATTGGTTCAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Nonsense 490 769 2 8
ENSDART00000132406 Nonsense 491 602 2 4
Genomic Location (Zv9):
Chromosome 5 (position 14703670)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13001107
GRCz11 5 13501324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGGGATTGGTCACTCTGGAGGACGTCATCGAGGAGATCATCAAATG[C/A]GAAATCCTGGACGAGTCTGACCTCTACAGTGAGTGGACAGTGGCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Essential Splice Site 763 769 None 8
ENSDART00000132406   None 602 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14749197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13040480
GRCz11 5 13540697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGACCACCTCGCTCCTCAACGAACAGAACAGCCAACCTGCYCGCCAGG[C/T]CAACCACAACACACACAACGAGAGTGCCATATGACACRCTYTCACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link