
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tuba4l
- Ensembl ID:
- ENSDARG00000074289
- ZFIN ID:
- ZDB-GENE-030131-5588
- Description:
- tubulin, alpha 4 like [Source:RefSeq peptide;Acc:NP_956089]
- Human Orthologues:
- TUBA4A, TUBA8
- Human Descriptions:
- tubulin, alpha 4a [Source:HGNC Symbol;Acc:12407]
- tubulin, alpha 8 [Source:HGNC Symbol;Acc:12410]
- Mouse Orthologues:
- Tuba4a, Tuba8
- Mouse Descriptions:
- tubulin, alpha 4A Gene [Source:MGI Symbol;Acc:MGI:1095410]
- tubulin, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:1858225]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa4487 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa4487
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115157 | Essential Splice Site | 124 | 449 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 13 (position 6287916)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 6121220 GRCz11 13 6249680 - KASP Assay ID:
- 554-3567.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATTGGAAAGGAGATYGTAGACTCTGTGCTTGATCGCATGCGCAAAATG[G/A]TGAGTTTGCACACTTGAATWATGGTTCTTMATTAGTAACAATTATTGYGT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: