zgc:175221

Ensembl ID:
ENSDARG00000074287
ZFIN ID:
ZDB-GENE-080305-8
Description:
serine palmitoyltransferase, long chain base subunit 2-like [Source:RefSeq peptide;Acc:NP_001108213
Human Orthologue:
SPTLC2
Human Description:
serine palmitoyltransferase, long chain base subunit 2 [Source:HGNC Symbol;Acc:11278]
Mouse Orthologue:
Sptlc2
Mouse Description:
serine palmitoyltransferase, long chain base subunit 2 Gene [Source:MGI Symbol;Acc:MGI:108074]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36959 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114316 Nonsense 126 558 3 12
Genomic Location (Zv9):
Chromosome 20 (position 5401108)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5316701
GRCz11 20 5361108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCCACTGTACCAGGACTTTGAGAACTTTTACACCAGGAATCTGTA[T/A]ATGAGGATCAGAGACAACTGGAACAGGCCCATATGCAGTGTTCCTGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link