si:dkey-29b11.2

Ensembl ID:
ENSDARG00000074286
ZFIN IDs:
ZDB-GENE-050809-95, ZDB-GENE-100922-168
Human Orthologue:
HINT3
Human Description:
histidine triad nucleotide binding protein 3 [Source:HGNC Symbol;Acc:18468]
Mouse Orthologue:
Hint3
Mouse Description:
histidine triad nucleotide binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1914097]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11555 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110100 Nonsense 22 160 1 5
Genomic Location (Zv9):
Chromosome 16 (position 42691507)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40074957
GRCz11 16 40024989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACACCGACACCTGAGAGCTGTATAGCAAGTCATTCWGATGAAGAATA[T/A]GACAAAAAATGTATTTTCTGTAAAATCTTRAAGGGKGAGATGGGAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link