ADAMTS20

Ensembl ID:
ENSDARG00000074281
Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 20 [Source:HGNC Symbol;Acc:17178]
Human Orthologue:
ADAMTS20
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 20 [Source:HGNC Symbol;Acc:17178]
Mouse Orthologue:
Adamts20
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30399 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110939 Essential Splice Site 274 678 8 15
Genomic Location (Zv9):
Chromosome Zv9_NA761 (position 9588)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150567.1 9588
GRCz11 KN150567.1 9588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGTTGCATAGTGAGATGTTGATCTTGACCTATTGTTCCTCCTTTCA[G/A]CTCTTTCTGACAGTCAGTCGAACTTCCTCCTGAACGGGAACTTCGTAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link