wrb

Ensembl ID:
ENSDARG00000074271
ZFIN ID:
ZDB-GENE-030131-7696
Description:
Tryptophan-rich protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DRM0]
Human Orthologue:
WRB
Human Description:
tryptophan rich basic protein [Source:HGNC Symbol;Acc:12790]
Mouse Orthologue:
Wrb
Mouse Description:
tryptophan rich basic protein Gene [Source:MGI Symbol;Acc:MGI:2136882]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35806 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30987 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114134 Essential Splice Site 30 170 1 5
Genomic Location (Zv9):
Chromosome 15 (position 5795885)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5914222
GRCz11 15 5902073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTGTGCAACCTCGTCAAAACATTCCTGCCATCCATTTCTTCATTT[G/T]TAAGTACTCAATTAAAACGAGTTTTAGGGACGCTTAAGCACATATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114134 Essential Splice Site 86 170 2 5
Genomic Location (Zv9):
Chromosome 15 (position 5798607)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5916944
GRCz11 15 5904795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGGAACGCAAGATCAACAAGATGACTGATCAACTCAAAACTCTTGG[T/G]AAATAAAACTCGTTCTTATTTTGCACATTACATGCATACGCAGCAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link