ZNF518A (1 of 2)

Ensembl ID:
ENSDARG00000074270
Description:
zinc finger protein 518A [Source:HGNC Symbol;Acc:29009]
Human Orthologue:
ZNF518A
Human Description:
zinc finger protein 518A [Source:HGNC Symbol;Acc:29009]
Mouse Orthologue:
Zfp518a
Mouse Description:
zinc finger protein 518A Gene [Source:MGI Symbol;Acc:MGI:1919922]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27974 Nonsense Mutation detected in F1 DNA During 2018
sa8549 Nonsense Mutation detected in F1 DNA During 2018
sa42054 Nonsense Mutation detected in F1 DNA During 2018
sa15166 Nonsense Available for shipment Available now
sa9134 Nonsense Mutation detected in F1 DNA During 2018
sa7224 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Nonsense 164 1254 1 3
ENSDART00000126390 Nonsense 158 1250 1 4
Genomic Location (Zv9):
Chromosome 12 (position 30777141)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29114078
GRCz11 12 29228980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACAAGTGGAGACCAAATGAGGACAATTCATCTGGTCTAAAATTGT[T/A]GCTTAAAAAGTCTCCTCCAGGTGGAGGGTCCAGAGAATCACAGTGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Nonsense 238 1254 1 3
ENSDART00000126390 Nonsense 232 1250 1 4
Genomic Location (Zv9):
Chromosome 12 (position 30776920)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29113857
GRCz11 12 29228759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTAATAAATGGACAAAATCTCCCCTTAAAAGTGAGCCACAWATATTG[C/T]AGCKCATTCCATCAGCAACACAGCAACCAAAGTTACAAGAKCATGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Nonsense 305 1254 1 3
ENSDART00000126390 Nonsense 299 1250 1 4
Genomic Location (Zv9):
Chromosome 12 (position 30776719)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29113656
GRCz11 12 29228558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTAGATGGCAAAAAGCATTTAGTTCTAAAGGTCATACCAACAAAA[C/T]AAGAGGACTCCACTGAAAGTGAGGTTTTTGAGTCACATATTAGTGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Nonsense 369 1254 2 3
ENSDART00000126390 Nonsense 404 1250 1 4
Genomic Location (Zv9):
Chromosome 12 (position 30776402)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29113339
GRCz11 12 29228241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGYTAAAGTACTKTCAACAGCATCAAAAGATCGCTCGCTTTCCCTGTG[T/A]CCGAGCCATAGATCGAATKGGAGGTCATCGCCTMCTCYYCACGAGATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Nonsense 504 1254 2 3
ENSDART00000126390 Nonsense 475 1250 2 4
Genomic Location (Zv9):
Chromosome 12 (position 30775999)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29112936
GRCz11 12 29227838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGAATCATTTGAGAATAAMAATGAACCTACTACAAGTTCTGTGRCT[G/T]AAGAAAGGCAAGGTCCTAATTCTGTCAAAGCTAAGACTTCACTATGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115358 Missense 917 1254 3 3
ENSDART00000126390 Essential Splice Site 921 1250 None 4
Genomic Location (Zv9):
Chromosome 12 (position 30774631)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29111568
GRCz11 12 29226470
KASP Assay ID:
554-5274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGCTGGGAGACAAGCTTACTTGGTTAGATACATTTCTTCAGCTAAG[T/C]CAAGAATACTTTTGAACAGTACAGATGGACAAACCCTGAGTCAGGACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link