zgc:123017

Ensembl ID:
ENSDARG00000074265
ZFIN ID:
ZDB-GENE-051113-196
Description:
Zinc finger protein DZIP1L [Source:UniProtKB/Swiss-Prot;Acc:Q32PN7]
Human Orthologue:
DZIP1L
Human Description:
DAZ interacting protein 1-like [Source:HGNC Symbol;Acc:26551]
Mouse Orthologue:
Dzip1l
Mouse Description:
DAZ interacting protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1919757]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33868 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33869 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115392 Essential Splice Site None 767 1 16
Genomic Location (Zv9):
Chromosome 6 (position 26022784)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 26323995
GRCz11 6 26314556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTATTCATATCAGAGCGAGATGAACCCTTACCCAGCACATTTACAGG[T/C]AAACATAAAATTGCTCTTATGCAAATATGAGATCTTTTTCATGTACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115392 Nonsense 641 767 14 16
Genomic Location (Zv9):
Chromosome 6 (position 26055609)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 26356820
GRCz11 6 26347381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTACCAGCTCAAGGGGAAATTTGTCCTCTTCTGTGCGTGTTGTTCAAT[C/A]AGGATCACTGCTGAACCCTACAACCGAGCCTGATTGGACAGACAGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link