zgc:194539

Ensembl ID:
ENSDARG00000074264
ZFIN ID:
ZDB-GENE-081022-122
Description:
Transmembrane protein 186 [Source:UniProtKB/Swiss-Prot;Acc:B3DI94]
Human Orthologue:
TMEM186
Human Description:
transmembrane protein 186 [Source:HGNC Symbol;Acc:24530]
Mouse Orthologue:
Tmem186
Mouse Description:
transmembrane protein 186 Gene [Source:MGI Symbol;Acc:MGI:1913940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112826 Nonsense 113 228 2 2
Genomic Location (Zv9):
Chromosome 22 (position 27476883)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26992328
GRCz11 22 26854780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGGCATCACTGTTGTCCTGCTGCCCACTGTGTATTACCTCCACCTG[C/T]AGGGCCAGGCATCAGTGTTGGTCTTAAATCGCTCAATAGGCATTGCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link