si:dkey-4m11.4

Ensembl ID:
ENSDARG00000074262
ZFIN ID:
ZDB-GENE-070912-547
Description:
Novel protein similar to vertebrate NCK adaptor protein 1 (NCK1) [Source:UniProtKB/TrEMBL;Acc:B0V0X4
Human Orthologue:
NCK1
Human Description:
NCK adaptor protein 1 [Source:HGNC Symbol;Acc:7664]
Mouse Orthologue:
Nck1
Mouse Description:
non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:109601]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39834 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111212 Nonsense 200 310 2 3
ENSDART00000144550 Nonsense 222 332 2 3
Genomic Location (Zv9):
Chromosome 2 (position 24739323)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25314100
GRCz11 2 24969734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAACACATAAGGAATTGGGCATTTCAGGGCCTCATCCTTCAAACTA[T/A]GACATTAAGCCCTCTATGGATGGAAAGTTTGGAGGAAAACAATGGTACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link