si:dkey-7j20.1

Ensembl ID:
ENSDARG00000074254
ZFIN ID:
ZDB-GENE-070912-584
Description:
Novel protein similar to ATP-binding cassette, sub-family B (MDR/TAP) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
ABCB6
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 [Source:HGNC Symbol;Acc:47]
Mouse Orthologue:
Abcb6
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1921354]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21450 Nonsense Available for shipment Available now
sa34589 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21449 Essential Splice Site Available for shipment Available now
sa21448 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113953 Nonsense 145 648 4 18
ENSDART00000135458 Nonsense 145 627 4 18
Genomic Location (Zv9):
Chromosome 9 (position 14542276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14294841
GRCz11 9 14266044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGGGTTTGTCAGTAACTTGCGCAGCTTCCTATGGACTCATGTGCAG[C/T]AGTACACCAGCCGTGTGGTGCAGGTGCGTCTGTTCGCTCATCTGCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113953 Essential Splice Site 332 648 8 18
ENSDART00000135458 Essential Splice Site 332 627 8 18
Genomic Location (Zv9):
Chromosome 9 (position 14537061)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14289626
GRCz11 9 14260829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGGATCATTGCTTTGTGCATACTATGTTACTGTGGACAAGTTTCAA[G/T]TATAGTAATCTCCACTCATACTGTAAAATCTACTTCTTATTGGTCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113953 Essential Splice Site 358 648 9 18
ENSDART00000135458 Essential Splice Site 358 627 9 18
Genomic Location (Zv9):
Chromosome 9 (position 14536896)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14289461
GRCz11 9 14260664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTGTTCAGCTCTACACGCCACTCAATTGGTTTGGCACATATTATAG[G/T]TAAGACTAGAAAATGACAATATAGGGTGTTGACAATTTCCCTGTGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113953 Essential Splice Site 590 648 16 18
ENSDART00000135458 Essential Splice Site 590 627 16 18
Genomic Location (Zv9):
Chromosome 9 (position 14503061)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14255626
GRCz11 9 14226829
KASP Assay ID:
2260-1622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTGCTAAGGTGTGTGCCAACCACACCACTCTCGTCGTCGCACATAG[G/A]TAAGTCTGCTTAATCCATTAACAGAATTGCTAATGCAACTTGAAGAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link