spen

Ensembl ID:
ENSDARG00000074245
ZFIN ID:
ZDB-GENE-050309-70
Description:
Si:ch211-125c5.1 protein [Source:UniProtKB/TrEMBL;Acc:Q58EE7]
Human Orthologue:
SPEN
Human Description:
spen homolog, transcriptional regulator (Drosophila) [Source:HGNC Symbol;Acc:17575]
Mouse Orthologue:
Spen
Mouse Description:
SPEN homolog, transcriptional regulator (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891706]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37704 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24332 Nonsense Available for shipment Available now
sa17259 Nonsense Available for shipment Available now
sa24331 Nonsense Available for shipment Available now
sa24330 Nonsense Available for shipment Available now
sa14508 Nonsense Available for shipment Available now
sa24329 Nonsense Available for shipment Available now
sa29926 Nonsense Mutation detected in F1 DNA During 2018
sa43981 Nonsense Mutation detected in F1 DNA During 2018
sa37703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Essential Splice Site 593 3476 8 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24739483)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24525603
GRCz11 23 24452144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGTATCTCACGAGGCACTTTTGTCGTTATGGACATGTAGTAAAG[G/T]TACTCTTTCTGTGCATGATTTACATTTTTTTAAACTCAAGTTCTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 658 3476 10 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24739070)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24525190
GRCz11 23 24451731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCTACCGTTCAATGCAGGGATCTGGACAAGACATAAGAGATTTCTA[T/A]GAAATCATATCTGAACGAAGGTGAGATTTTATATTTTAATATTTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 672 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24738941)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24525061
GRCz11 23 24451602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCATATAATTTGTCTTTTTTTTTNCAGAGATGAGCGCCGGACGCCATA[T/G]CAYGAGTTCACAGCTGAACGTGCATACTATGAAAATGTGCGTACCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 721 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24738796)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24524916
GRCz11 23 24451457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGTTTTTTTCAGAATGGGATCCCTACCAGGGAGATTACTATGACCCA[C/T]GATATTATGATGACTCCCGTGAATACAGGGATTTTAGAGACCCATATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 1153 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24737500)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24523620
GRCz11 23 24450161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCATTAGATAGCCTTGATCAAAAGATAGGTGCTTTTGGAGCTAACAGA[C/T]AACCAAGTTTCAGTCTTGCAGTCTCCGACGATGGAAGTGTAGATATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 1395 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24736774)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24522894
GRCz11 23 24449435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGAGAGAAATGAGCTTTCCCACAAGCATTGTTAAACGGGAAAGTATC[A/T]GAAAACGTCCTGAACGCGAATTAGAACCTGGAGAGGTTCAGTCAGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 1449 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24736610)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24522730
GRCz11 23 24449271
KASP Assay ID:
2261-7744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTTTCAGATGTAAAGTATTCTGAGTCTCTTGAAAAGAATAAGTTCTA[T/A]GAATTTGCATTGGATAAGACGATAACACCAGACACAAAAGCTTTGCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 1512 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24736422)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24522542
GRCz11 23 24449083
KASP Assay ID:
2261-7742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACAAGGAAAAGTCTGAACCTACTCCAAGACCTATTCCTTCATGGTACT[T/A]GAAGAAAAAGAAAAGTCGCTCTGACTCTGATGGAAAACTTGATGAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 2371 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24733846)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24519966
GRCz11 23 24446507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATCCAGAGGGAGGAAGGTTTCTTTGAACAGAAAATTAGATATTGCT[G/T]AGGATGTAGTGCTGGAACCTGAATCCACTACAGTCAAACTTCCAGAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109248 Nonsense 2606 3476 11 15

The following transcripts of ENSDARG00000074245 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24733141)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24519261
GRCz11 23 24445802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATAGACCTAGCCCTATAGCTCAGCTTGTACCCCGTACAACACCACCG[C/T]AGCCCCCTCCTCTACAACAATGTGAGACTCCACAGATCTTAAAGGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link