si:dkeyp-46c9.4

Ensembl ID:
ENSDARG00000074238
ZFIN ID:
ZDB-GENE-081104-468
Description:
Novel protein similar to human and mouse bromodomain and PHD finger containing, 3 (BRPF3) [Source:Un
Human Orthologue:
BRPF3
Human Description:
bromodomain and PHD finger containing, 3 [Source:HGNC Symbol;Acc:14256]
Mouse Orthologue:
Brpf3
Mouse Description:
bromodomain and PHD finger containing, 3 Gene [Source:MGI Symbol;Acc:MGI:2146836]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21211 Nonsense Available for shipment Available now
sa31632 Nonsense Available for shipment Available now
sa2418 Essential Splice Site F2 line generated During 2018
sa34326 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109819 Nonsense 12 543 1 10
ENSDART00000140717   None 585 None 8
Genomic Location (Zv9):
Chromosome 8 (position 11827664)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10841460
GRCz11 8 10879165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGCTTTTGTAGGTGAAGATTCACCAGGCAGTGACTGAGCATCAGT[T/G]AACTCCGGTTCTGGTACTGCTGAGCTCCACTTTAGAGCAGCTTCAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109819 Nonsense 194 543 3 10
ENSDART00000140717 Nonsense 151 585 2 8
Genomic Location (Zv9):
Chromosome 8 (position 11822417)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10846707
GRCz11 8 10884412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCATGCGCTCGAGCGGCGCACGAACACGACGGGTCCGCCTGCTGCGA[C/T]GAGAAATCAACAAAGTCCGCTTTAAGCAGAACTTAAAAAACTCACACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2418
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109819 Essential Splice Site 491 543 9 10
ENSDART00000140717 Essential Splice Site 473 585 6 8
Genomic Location (Zv9):
Chromosome 8 (position 11813883)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10855241
GRCz11 8 10892946
KASP Assay ID:
554-2536.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTGGTGTGGGCCAAAAGCAGAGGATATCCGTCCTACCCTGCTCTGG[T/C]GAGAGRGGGCGCTCTAYGCCTATATTACTATCAAACTAYACTGSAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109819 Nonsense 543 543 10 10
ENSDART00000140717 Nonsense 525 585 7 8
Genomic Location (Zv9):
Chromosome 8 (position 11811911)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10857213
GRCz11 8 10894918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGGAGAAAGACTTTTCCTGGTTCTCTTCTTCGACAACAAACGCACCT[G/A]GTGAGCCCAGCCTTTGGAGATTTTCTTGTTTTCCTTCAGATTACCCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link