zgc:172112

Ensembl ID:
ENSDARG00000074236
ZFIN IDs:
ZDB-GENE-080204-43, ZDB-GENE-080204-43
Description:
connector enhancer of kinase suppressor of ras 3 [Source:RefSeq peptide;Acc:NP_001107119]
Human Orthologues:
CNKSR3, IPCEF1
Human Descriptions:
CNKSR family member 3 [Source:HGNC Symbol;Acc:23034]
interaction protein for cytohesin exchange factors 1 [Source:HGNC Symbol;Acc:21204]
Mouse Orthologues:
Cnksr3, Ipcef1
Mouse Descriptions:
Cnksr family member 3 Gene [Source:MGI Symbol;Acc:MGI:2674130]
interaction protein for cytohesin exchange factors 1 Gene [Source:MGI Symbol;Acc:MGI:2444159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23627 Essential Splice Site Available for shipment Available now
sa23628 Essential Splice Site Available for shipment Available now
sa18621 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114830 Essential Splice Site 73 546 3 13
ENSDART00000125798 Essential Splice Site 73 546 3 13
Genomic Location (Zv9):
Chromosome 20 (position 4223350)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4165029
GRCz11 20 3866870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCCTGGCTGGTGGCCTTGCTTAATGCTTTGTTACTGTGTATTTTGC[A/G]GAACTGTGGCGTGGAGACTGATAACTTGAAGACTCTGGTTGGTCAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114830 Essential Splice Site 183 546 5 13
ENSDART00000125798 Essential Splice Site 183 546 5 13
Genomic Location (Zv9):
Chromosome 20 (position 4227731)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4169066
GRCz11 20 3862841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCAGGACTGCACTGTTTTTGAAATGGAGGAGAAGATATTAGAAGTG[G/A]TGAGTAGAACGTTTTGCCGTCAGCCATTTTGCACACATTCACATATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114830 Essential Splice Site 223 546 6 13
ENSDART00000125798 Essential Splice Site 223 546 6 13
Genomic Location (Zv9):
Chromosome 20 (position 4231413)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4172748
GRCz11 20 3859159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTRGAGGAGGTRCCCATCAGCAATATCAAAYCTGGCGAGGGACTGG[T/A]GCGTGTCAACAGCCTTTACACTTCTCCACCTGCTGCCTTTGTTTACTCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link