zgc:175145

Ensembl ID:
ENSDARG00000074222
ZFIN ID:
ZDB-GENE-080722-11
Description:
hypothetical protein LOC100170821 [Source:RefSeq peptide;Acc:NP_001124128]
Human Orthologue:
RAP1GAP2
Human Description:
RAP1 GTPase activating protein 2 [Source:HGNC Symbol;Acc:29176]
Mouse Orthologue:
Rap1gap2
Mouse Description:
RAP1 GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:3028623]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23979 Essential Splice Site Available for shipment Available now
sa37348 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37347 Nonsense Mutation detected in F1 DNA During 2018
sa10392 Essential Splice Site Available for shipment Available now
sa10469 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111571 Essential Splice Site 244 696 9 23
ENSDART00000127181 Essential Splice Site 270 722 11 25
Genomic Location (Zv9):
Chromosome 21 (position 29813735)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31013986
GRCz11 21 31050681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTAAACAACACCTTCAAGTTTGGTGTCATTTACCAAAAGTTTGGGCAG[G/A]TGAGGACATTAATGCTGAATGTGTGTAGTTTTTGTACCATTATAAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111571 Essential Splice Site 278 696 10 23
ENSDART00000127181 Essential Splice Site 304 722 12 25
Genomic Location (Zv9):
Chromosome 21 (position 29813365)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31013616
GRCz11 21 31050311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTCTCCGAGTGCTGGGAGACTGTGTCCAACTGCAAGACTTTAAAGG[G/T]TATATAAAAAAAAGAGTTGATAAATAAAATATGAATGTGATTTGTTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111571 Nonsense 302 696 11 23
ENSDART00000127181 Nonsense 328 722 13 25
Genomic Location (Zv9):
Chromosome 21 (position 29804791)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31005042
GRCz11 21 31041737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCACGGTCAGACGGGTTCTCAGTCGGTCTACACTGTGTTTAAAGGA[C/T]AGGAACTAATGTTTCACATCTCCACCAAGCTACCATATATTGAGGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111571 Essential Splice Site 322 696 12 23
ENSDART00000127181 Essential Splice Site 348 722 14 25
Genomic Location (Zv9):
Chromosome 21 (position 29804546)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31004797
GRCz11 21 31041492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAYWTTAGAGATAAAACGTGACTCTATTCTTTATCCTGTAAATGCTCT[A/C]GCTCCAAAGGAAGCGTCACATTGGGAATGACATTGTGGCTGCAGTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111571 Essential Splice Site 523 696 16 23
ENSDART00000127181 Essential Splice Site 549 722 18 25
Genomic Location (Zv9):
Chromosome 21 (position 29796133)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30996384
GRCz11 21 31033079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGGAGTCAGTCTGACGCACAGCAGCTCTGAGGCCGCAAAAAACTCAG[T/C]GAGCATCTWATTACATTCACACAGATAAACCACATCTGAACAGCTAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link