si:dkey-26i13.2

Ensembl ID:
ENSDARG00000074213
ZFIN ID:
ZDB-GENE-090312-175
Human Orthologue:
EIF3B
Human Description:
eukaryotic translation initiation factor 3, subunit B [Source:HGNC Symbol;Acc:3280]
Mouse Orthologue:
Eif3b
Mouse Description:
eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32612 Nonsense Mutation detected in F1 DNA During 2018
sa6576 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111041 Nonsense 192 594 5 16
ENSDART00000134531 Nonsense 149 648 4 17

The following transcripts of ENSDARG00000074213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10874352)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11006429
GRCz11 1 11693229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCCAGACTGTCGTGATCAATACAGTGTAATCTATGAGTCGGGAGAG[C/T]GAACCGCCATATTCTCGAATGACCCAAAGGAGCCGATACTGGTGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111041 Nonsense 572 594 16 16
ENSDART00000134531 Nonsense 530 648 14 17

The following transcripts of ENSDARG00000074213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10881735)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11013812
GRCz11 1 11700612
KASP Assay ID:
554-4742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCATACTGGCTTTGGACRTTCCAGGGTCGTCTTCTGCAAAAGAACAAC[A/T]AAGATAGATTCTGCCAATTGCTWYGGAGACCACGCCCTCCTACTTTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link