
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-26i13.2
- Ensembl ID:
- ENSDARG00000074213
- ZFIN ID:
- ZDB-GENE-090312-175
- Human Orthologue:
- EIF3B
- Human Description:
- eukaryotic translation initiation factor 3, subunit B [Source:HGNC Symbol;Acc:3280]
- Mouse Orthologue:
- Eif3b
- Mouse Description:
- eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32612 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6576 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32612
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111041 | Nonsense | 192 | 594 | 5 | 16 |
ENSDART00000134531 | Nonsense | 149 | 648 | 4 | 17 |
The following transcripts of ENSDARG00000074213 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 10874352)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 11006429 GRCz11 1 11693229 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATCCAGACTGTCGTGATCAATACAGTGTAATCTATGAGTCGGGAGAG[C/T]GAACCGCCATATTCTCGAATGACCCAAAGGAGCCGATACTGGTGGAAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6576
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111041 | Nonsense | 572 | 594 | 16 | 16 |
ENSDART00000134531 | Nonsense | 530 | 648 | 14 | 17 |
The following transcripts of ENSDARG00000074213 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 10881735)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 11013812 GRCz11 1 11700612 - KASP Assay ID:
- 554-4742.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGCATACTGGCTTTGGACRTTCCAGGGTCGTCTTCTGCAAAAGAACAAC[A/T]AAGATAGATTCTGCCAATTGCTWYGGAGACCACGCCCTCCTACTTTACTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: