SLC5A10

Ensembl ID:
ENSDARG00000074212
Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 [Source:HGNC Symbol;Acc:23155]
Human Orthologue:
SLC5A10
Human Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 [Source:HGNC Symbol;Acc:23155]
Mouse Orthologue:
Slc5a10
Mouse Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19416 Essential Splice Site Available for shipment Available now
sa19417 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Essential Splice Site 168 642 8 17
Genomic Location (Zv9):
Chromosome 1 (position 7150473)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7439382
GRCz11 1 8123493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCATCAAGAGAGAATTGAGCAAGAACCTTTCAGTCCTGTGTTTCTGC[A/T]GGTGGCTTGGCTGCTGTAATCTACACCGACACTCTTCAGACCTTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Nonsense 382 642 12 17
Genomic Location (Zv9):
Chromosome 1 (position 7171100)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7460009
GRCz11 1 8144120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAACAGCAGCAGCACCCTCTTCACCATGGACATCTGGAAGAAATAT[C/T]GAAGAGGTGCAAGCGAAAAAGAGCTGCTACTTGTTGGCAGGTATTAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link