zgc:110286

Ensembl ID:
ENSDARG00000074210
ZFIN ID:
ZDB-GENE-050417-68
Description:
hypothetical protein LOC550265 [Source:RefSeq peptide;Acc:NP_001017602]
Human Orthologues:
ARF4, ARF5
Human Descriptions:
ADP-ribosylation factor 4 [Source:HGNC Symbol;Acc:655]
ADP-ribosylation factor 5 [Source:HGNC Symbol;Acc:658]
Mouse Orthologues:
Arf4, Arf5
Mouse Descriptions:
ADP-ribosylation factor 4 Gene [Source:MGI Symbol;Acc:MGI:99433]
ADP-ribosylation factor 5 Gene [Source:MGI Symbol;Acc:MGI:99434]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35156 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089963 Nonsense 167 181 5 5
Genomic Location (Zv9):
Chromosome 11 (position 43560432)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42190851
GRCz11 11 42481413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCAGTGGTTTGTTCAGTCCACATGTGCAGTTCAGGGATCTGGTT[T/A]ATATGAAGGACTCGACTGGCTCACAGATCAACTCTCCAAACGATAATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Genome-wide association study in a Chinese population identifies a susceptibility locus for type 2 diabetes at 7q32 near PAX4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link