
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110286
- Ensembl ID:
- ENSDARG00000074210
- ZFIN ID:
- ZDB-GENE-050417-68
- Description:
- hypothetical protein LOC550265 [Source:RefSeq peptide;Acc:NP_001017602]
- Human Orthologues:
- ARF4, ARF5
- Human Descriptions:
- ADP-ribosylation factor 4 [Source:HGNC Symbol;Acc:655]
- ADP-ribosylation factor 5 [Source:HGNC Symbol;Acc:658]
- Mouse Orthologues:
- Arf4, Arf5
- Mouse Descriptions:
- ADP-ribosylation factor 4 Gene [Source:MGI Symbol;Acc:MGI:99433]
- ADP-ribosylation factor 5 Gene [Source:MGI Symbol;Acc:MGI:99434]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35156 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35156
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089963 | Nonsense | 167 | 181 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 43560432)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 42190851 GRCz11 11 42481413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCTCTCAGTGGTTTGTTCAGTCCACATGTGCAGTTCAGGGATCTGGTT[T/A]ATATGAAGGACTCGACTGGCTCACAGATCAACTCTCCAAACGATAATACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Type 2 diabetes: Genome-wide association study in a Chinese population identifies a susceptibility locus for type 2 diabetes at 7q32 near PAX4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: