
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
flna
- Ensembl ID:
- ENSDARG00000074201
- ZFIN ID:
- ZDB-GENE-030131-2145
- Human Orthologue:
- FLNA
- Human Description:
- filamin A, alpha [Source:HGNC Symbol;Acc:3754]
- Mouse Orthologue:
- Flna
- Mouse Description:
- filamin, alpha Gene [Source:MGI Symbol;Acc:MGI:95556]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43949 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43950 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43951 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa17303 | Essential Splice Site | Available for shipment | Available now |
sa24296 | Nonsense | Available for shipment | Available now |
sa24297 | Essential Splice Site | Available for shipment | Available now |
sa32439 | Nonsense | Available for shipment | Available now |
sa24298 | Essential Splice Site, Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43949
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Nonsense | 349 | 2614 | 5 | 47 |
ENSDART00000135820 | Nonsense | 349 | 2553 | 5 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20065182)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19850289 GRCz11 23 19776632 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCAAAGTCACAGCCAACAATGACAAGAACCGCACCTACTCAGTATTCTA[T/G]GTGCCAAAAGTCACTGGACAACACAAGGTACCCAGAACTGTTTGTATAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43950
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Essential Splice Site | 358 | 2614 | 5 | 47 |
ENSDART00000135820 | Essential Splice Site | 358 | 2553 | 5 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20065210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19850317 GRCz11 23 19776660 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCGCACCTACTCAGTATTCTATGTGCCAAAAGTCACTGGACAACACAAG[G/A]TACCCAGAACTGTTTGTATAAGTTAGCGATTGAATGGGTTGAAATGGAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43951
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Essential Splice Site | 526 | 2614 | 8 | 47 |
ENSDART00000135820 | Essential Splice Site | 526 | 2553 | 8 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20070757)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19855864 GRCz11 23 19782207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAAAGGAGCAGGAACCGGAGACCTCAAAGTTACCATCAAAGGGCCCAG[T/C]GAGTGGACGTCTATATTAATGCTGCAGTGCTAGATGATTTATCATGCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17303
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Essential Splice Site | 891 | 2614 | 16 | 47 |
ENSDART00000135820 | Essential Splice Site | 891 | 2553 | 16 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20075148)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19860255 GRCz11 23 19786598 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATGATGCAAGCAAGGTTAAAGCTGAGGGGCCTGGACTTAGCCGTTCTGG[T/A]AAGATAATGGACACAAAACTAACTTGTGCGTCCCTGCTTAKAATGATGGY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24296
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Nonsense | 1294 | 2614 | 22 | 47 |
ENSDART00000135820 | Nonsense | 1236 | 2553 | 21 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20077163)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19862270 GRCz11 23 19788613 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGATCCGAGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTA[T/G]GAGGAGGGTGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24297
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Essential Splice Site | 1296 | 2614 | 22 | 47 |
ENSDART00000135820 | Essential Splice Site | 1238 | 2553 | 21 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20077171)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19862278 GRCz11 23 19788621 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTATGAGGAGG[G/A]TGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAAAAAACAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32439
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Nonsense | 1813 | 2614 | 33 | 47 |
ENSDART00000135820 | Nonsense | 1753 | 2553 | 32 | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20087028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19872135 GRCz11 23 19798478 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAAATATGCCCCAACTGAGGCGGGCCTGCATGAGATGGACATTAAATA[T/A]GATGGAATACACATTCCAGGTAAAAGACATGTATTCTCAATGTACAAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24298
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site, Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073442 | Splice Site | 2270 | 2614 | 41 | 47 |
ENSDART00000135820 | Essential Splice Site | 2210 | 2553 | None | 46 |
ENSDART00000142228 | None | 353 | None | 7 |
The following transcripts of ENSDARG00000074201 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20090248)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19875355 GRCz11 23 19801698 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACCGTAAAGATGGATCCAGTGGTGTCTCTTACATCGTCCAGGAGCCTGG[T/C]AAGGTTTTCCTTTTTTTAATTGTTTTTATTTATTTATTTTTTTACTTCAG
- Associated Phenotype:
- Not determined
OMIM
- Cardiac valvular dysplasia, X-linked
- Congenital short bowel syndrome
- FG syndrome 2
- Frontometaphyseal dysplasia
- Heterotopia, periventricular
- Heterotopia, periventricular, ED variant
- Intestinal pseudoobstruction, neuronal
- Melnick-Needles syndrome
- Otopalatodigital syndrome, type I
- Otopalatodigital syndrome, type II
- Terminal osseous dysplasia
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: