ADAM23 (1 of 2)

Ensembl ID:
ENSDARG00000074197
Description:
ADAM metallopeptidase domain 23 [Source:HGNC Symbol;Acc:202]
Human Orthologue:
ADAM23
Human Description:
ADAM metallopeptidase domain 23 [Source:HGNC Symbol;Acc:202]
Mouse Orthologue:
Adam23
Mouse Description:
a disintegrin and metallopeptidase domain 23 Gene [Source:MGI Symbol;Acc:MGI:1345162]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45342 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111703 Nonsense 685 718 26 27
Genomic Location (Zv9):
Chromosome 9 (position 1285580)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1294734
GRCz11 9 1297022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGTCTGGCTGACCCTCCAAAAGAGCCAGAACCCGATGAAGATGAA[G/T]GACCTAAGGGTTTGTTGCTCTTACACTTACAGATGAAGTCAGAGATATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link