
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TOB2
- Ensembl ID:
- ENSDARG00000074195
- Description:
- transducer of ERBB2, 2 [Source:HGNC Symbol;Acc:11980]
- Human Orthologue:
- TOB2
- Human Description:
- transducer of ERBB2, 2 [Source:HGNC Symbol;Acc:11980]
- Mouse Orthologue:
- Tob2
- Mouse Description:
- transducer of ERBB2, 2 Gene [Source:MGI Symbol;Acc:MGI:1888525]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15324 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15324
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115007 | Nonsense | 308 | 339 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 5677303)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 5132027 GRCz11 3 5041868 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCCAGTCCACCKCCAGGTCAGGCCGTCGGAATCATTGGAAGCAACAGT[G/T]GAATTTCATTCATGGACAAATCACCATTTGTGGAAGGACTGGGATACAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: