zgc:172253

Ensembl ID:
ENSDARG00000074191
ZFIN ID:
ZDB-GENE-080215-9
Description:
hypothetical protein LOC100007732 [Source:RefSeq peptide;Acc:NP_001107955]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9994 Nonsense Available for shipment Available now
sa10381 Nonsense Available for shipment Available now
sa9595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113778 Nonsense 504 549 5 5
ENSDART00000143449 Nonsense 520 565 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1809369)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1267581
GRCz11 3 1036230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTCTTTCTGCCATGTCTCGTGCCACAGATGATTTCAAAAGATTATA[T/A]TCTGGATATGCWAAGCCTTTTCAGGAAGAGACAATCCTYTGTGTTATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113778 Nonsense 542 549 5 5
ENSDART00000143449 Nonsense 558 565 5 5
ENSDART00000113778 Nonsense 542 549 5 5
ENSDART00000143449 Nonsense 558 565 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1809481)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1267693
GRCz11 3 1036342
KASP Assay ID:
2259-2899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTCCAATCCAGGTGCCTCCATCTATGCTTWTTCATMTGGAGAATTG[C/T]AAACTAAACGGTTTCCTTCACTTTAGCCTCMGGAGGGKGGTRCTTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113778 Nonsense 542 549 5 5
ENSDART00000143449 Nonsense 558 565 5 5
ENSDART00000113778 Nonsense 542 549 5 5
ENSDART00000143449 Nonsense 558 565 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1809481)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1267693
GRCz11 3 1036342
KASP Assay ID:
2259-2899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTCCAATCCAGGTGCCTCCATCTATGCTTWTTCATATGGAGAATTG[C/T]AAACTAAACGGTTTCCTTCACTTTAGCCTCMGGAGGGKGGTRCTTCTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link