si:dkey-51a16.7

Ensembl ID:
ENSDARG00000074179
ZFIN ID:
ZDB-GENE-081028-65
Human Orthologue:
CALHM2
Human Description:
calcium homeostasis modulator 2 [Source:HGNC Symbol;Acc:23493]
Mouse Orthologue:
Calhm2
Mouse Description:
calcium homeostasis modulator 2 Gene [Source:MGI Symbol;Acc:MGI:1919941]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38939 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111034 Nonsense 110 294 1 3
ENSDART00000134596 Nonsense 109 309 1 2
Genomic Location (Zv9):
Chromosome 13 (position 25642775)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25288435
GRCz11 13 25418885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAATTATCGCTGACTGCTGCGTTTGTTCTGTTGGGATCTATCGTGGGC[A/T]GAGCAATTGCTGCCCCCATCACATGGACTGTGATTTCGCTTCTAAGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link