zgc:165514

Ensembl ID:
ENSDARG00000074171
ZFIN ID:
ZDB-GENE-041008-169
Description:
hypothetical protein LOC449909 [Source:RefSeq peptide;Acc:NP_001092705]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35997 Nonsense Mutation detected in F1 DNA During 2018
sa42626 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110811 Nonsense 204 297 3 4
Genomic Location (Zv9):
Chromosome 15 (position 43068830)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149945.1 3450
GRCz11 15 44188353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTTCTGTGAAAAGAGATTTTCACGTCTGGGTCATTGTAAACAGCAC[C/T]AGAAAACACACACTGACGAGAGAGAGATCATGTGTGTTCGGAGTGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110811 Nonsense 236 297 4 4
Genomic Location (Zv9):
Chromosome 15 (position 43068729)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149945.1 3349
GRCz11 15 44188452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTTTATAAGAGTCGACCATCTGAAAATTCACCAGAGGATTCACACT[G/T]GAGAAAAACCTCACAAGTGCTCATATTGTGAGAAGAGTTTCTGTCGGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link