TNRC6B (1 of 3)
- Ensembl ID:
- ENSDARG00000074161
- Description:
- trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
- Human Orthologue:
- TNRC6B
- Human Description:
- trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
- Mouse Orthologue:
- Tnrc6b
- Mouse Description:
- trinucleotide repeat containing 6b Gene [Source:MGI Symbol;Acc:MGI:2443730]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa2628 |
Essential Splice Site |
F2 line generated |
During 2018 |
sa42013 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35263 |
Splice Site, Nonsense |
Available for shipment |
Available now |
sa7358 |
Missense |
Mutation detected in F1 DNA |
During 2018 |
sa35264 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa22079 |
Nonsense |
Available for shipment |
Available now |
sa45458 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa11065 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa2628
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Essential Splice Site |
31 |
1736 |
2 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20379722)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19161566 |
GRCz11 |
12 |
19283440 |
- KASP Assay ID:
- 554-2537.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AATTAAAATATATGTTTTCATCAAATTTGTATCTCCTTTTTTATTGTTTT[A/C]GGTTGCAGAGCAAAAAAATAAAGGTAACTATTTTATTTCCATCTTTAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42013
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Nonsense |
78 |
1736 |
4 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20380106)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19161950 |
GRCz11 |
12 |
19283824 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTCCCTCAGGGTGGGAACAATGCTAAGCGGCCGGCGGTGGCCAACGGA[C/T]AGCCCTCCCCCAGCACACCGAATTCTCAGCGCTACATGCCCCGTGAAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35263
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Splice Site, Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Splice Site, Nonsense |
138 |
1736 |
4 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20380287)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19162131 |
GRCz11 |
12 |
19284005 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAGGCAACAGCGGGGGAGACAGCCCCAATGAAACAGTGGCTTCTGCCT[C/A]AGGTAGGAATCATTAGGTTAATAATTTAAATTGCATAGTTACATTTTTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7358
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Missense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Missense |
306 |
1736 |
6 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20381036)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19162880 |
GRCz11 |
12 |
19284754 |
- KASP Assay ID:
- 554-4316.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GATTCCAGGTGCCAATTTTACCCCTAATGCCAATCCCTCTGCTTGGCCAG[C/T]CCKAGTACAGGAAGGGGCTGGGACAGTTGCAACAGAGGGTGGCTCCTCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35264
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Nonsense |
409 |
1736 |
6 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20381344)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19163188 |
GRCz11 |
12 |
19285062 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGCTCTGCTTCGTCTTCCTCCTCCACCAGCTCATCATTGTGGAGAACT[C/T]AGCCTTTCCCTGCAAACTTCAAAACGGGTGCCTCAAGGACTGAATCTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22079
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Nonsense |
789 |
1736 |
8 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20382849)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19164693 |
GRCz11 |
12 |
19286567 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTG[T/A]CAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45458
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Essential Splice Site |
808 |
1736 |
8 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20382908)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19164752 |
GRCz11 |
12 |
19286626 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGGTCCTTCAG[T/C]CCAGAGCCAAAGTTCAGGGTGGAATTCAGGGCCTATACCCCAAATTTCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11065
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000114402 |
Nonsense |
838 |
1736 |
9 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 20383074)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
19164918 |
GRCz11 |
12 |
19286792 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTA[C/A]AACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following
GWAS studies:
- Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
- Prostate cancer: A meta-analysis of genome-wide association studies to identify prostate cancer susceptibility loci associated with aggressive and non-aggressive disease. (View Study)
- Prostate cancer: Sequence variants at 22q13 are associated with prostate cancer risk. (View Study)
- Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
- Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: