LOC100148532

Ensembl ID:
ENSDARG00000074160
Human Orthologue:
PAQR4
Human Description:
progestin and adipoQ receptor family member IV [Source:HGNC Symbol;Acc:26386]
Mouse Orthologue:
Paqr4
Mouse Description:
progestin and adipoQ receptor family member IV Gene [Source:MGI Symbol;Acc:MGI:1923748]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35228 Nonsense Mutation detected in F1 DNA During 2018
sa41982 Nonsense Mutation detected in F1 DNA During 2018
sa19031 Nonsense Mutation detected in F1 DNA During 2018
sa9849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 20 272 1 3
Genomic Location (Zv9):
Chromosome 12 (position 14270807)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13126460
GRCz11 12 13164763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTACTGGACCAAAACTTCTGGATTTTAAGAGCTCACCACCACATCTT[C/T]AGTTCAACAAGTATGTCCATACAGGATACCGGCCTATATCCACTTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 152 272 3 3
Genomic Location (Zv9):
Chromosome 12 (position 14282543)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13138196
GRCz11 12 13176499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACATTGTTGTGTCACCCAATCACCCGTCAAGTGGCGATGTTAGCGTA[T/A]CTCCTCCTCTCTGGCTATGGTGTTCACTGCGCTCTCACTGCAGAGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 262 272 3 3
ENSDART00000112565 Nonsense 262 272 3 3
Genomic Location (Zv9):
Chromosome 12 (position 14282871)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13138524
GRCz11 12 13176827
KASP Assay ID:
2260-5099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGTTCTGTCTATACTTTACTTACACTGGGGCATGCTGGAGGATTTA[C/T]GATGGTTAAAGGGATATCACTGTCCTGATGAATATGGCATTTATGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 262 272 3 3
ENSDART00000112565 Nonsense 262 272 3 3
Genomic Location (Zv9):
Chromosome 12 (position 14282871)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13138524
GRCz11 12 13176827
KASP Assay ID:
2260-5099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTSGTTCTGTCTAWACTKTACTTACACTGGGGCATGCTGGAGGATTTA[C/T]GATGGTTAAAGGGRTATCACTGTCCTGATGAATATGGYATTTATGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link